85 μg per well for 20 h at 20°C and the wells were subsequently blocked with 2% BSA/PBS for 2 h at 20°C. 100 μl clarified supernatants or 20 nM of purified His-polypeptides were added and left to react with the immobilized proteins for 2 h at +37°C. Bound, extracellularly secreted polypeptides were detected with anti-FLAG® M2 mAb (0.5 μg/ml in 1% BSA/PBS) and bound, purified 6xHis polypeptides with anti-His mAb (0.1 μg/ml in 1% BSA/PBS, Clontech Laboratories). Alkaline phosphatase-conjugated antibodies (1 μg/ml in 1% BSA/PBS, Dako) were used as secondary antibodies, P-nitrophenyl phosphate (Sigma-Aldrich) Neuronal Signaling inhibitor was used

as a substrate, and the absorbance was measured in a Multiscan Titertek recorder (Eflab) at 405 nm. Reaction volumes were in all steps 100 μl per well. In Western blotting, samples corresponding to 100 or 500 μl of growth medium and 50 μl bacterial culture were analyzed in a 20% SDS-PAGE gel and transferred onto 0.2 μm nitrocellulose membranes. The detection was done using anti-FLAG antibody (0.5 μg/ml in 1% BSA/PBS) and alkaline phosphatase-conjugated anti-mouse

antibody (1.5 μg/ml in 1% BSA/PBS). SPR assay The interaction between purified His-polypeptides and Fn as well as Fg was analyzed by SPR technology using the Biacore T100 instrument, CM5 sensor chips and amine coupling chemistry according to the this website manufacturer’s instructions (GE Healthcare). selleck compound Single cycle kinetics was applied in the measurements [67]. Briefly, ligands were diluted in sodium acetate, pH 4.5 to 30 μg/ml (Fn) and 80 μg/ml (Fg) and applied onto activated sensor chip surface at flow rates 10 μl/min for 7 min with Fg and 5 μl/min for 9 min with Fn. His-polypeptides used as analytes at concentrations of 0.5 μM, 1.0 μM, 1.5 μM, 2.0 μM and 2.5 μM in PBS were injected at a flow rate of 30 μl/min using PBS as a running buffer. Regeneration of the surface Flavopiridol (Alvocidib) was done between the different analytes using 10 mM

glycine, pH 2.3 for Fg and 5 mM NaOH for Fn; control samples were used to confirm that regeneration did not affect the binding. PCR screening and sequencing of the clones Colony PCR was used to estimate the cloning efficiency, i.e. the% insert-carrying transformants of all transformants in the primary genomic library, from 200 randomly picked colonies and to estimate the average insert size of 200 randomly picked insert-containing clones. The colony PCR was performed using Dynazyme II DNA polymerase (Finnzymes), the PCR primers 017F (5′ taccaacagcctctcgctg 3′) and 028R (5′ caattcaacttgtaggcctgata 3′) purchased from Medprobe shown in Figure 1A, recombinant bacterial cells as templates, and applying standard recombinant DNA techniques [65]. The insertions in the 1663 Ftp clones were amplified by PCR using the primers 025F (5′ ggcgattgagccgacgg 3′) and 028R and the recombinant plasmids as templates.